TTV, a nonenveloped single-stranded circular DNA virus first identified by representational difference analysis in a Japanese patient with hepatitis of unknown etiology, appears to be widely distributed. Although definitive evidence for disease association is unavailable, genetic data on TTV strains have been reported from various geographical regions, including the United States, Europe and Asia. We have now analyzed the 4,280 nucleotide (nt) full-length sequence of a TTV variant, designed SI01, amplified from a plasma sample collected from a Melanesian resident of Solomon Islands. Overall, the circular genome of SI01 was 427 nt longer than the prototype TA278 from Japan. SI01 shared 51.6%, 46%, 44.2%, 49.9%, and 50.5% nucleotide sequence similarity with TA278 (prototype strain from Japan, genotype 1a), JA20 (genotype 1b from Japan), JA4 (genotype 2 from Japan) , US35 (genotype 2 from the United States), and JA2B (genotype 3 from Japan), respectively. SI01 possessed two open reading frames coding for 778 and 199 amino acids, respectively, each with approximately 50% homology with the gene products of TA278. The 1,437-nt noncoding region of SI01 contained a 27 nt repeat sequence (AAGGGGGCTCCGCCCCCTTACACCCCC), which was 58% homologous to that of TA278. Phylogenetic analysis revealed that SI01 represented a distinctly new TTV genotype. Efforts are underway to investigate the genetic diversity of TTV elsewhere in Melanesia.